5/find_cag_short.pl


#!/usr/bin/perl -w

use strict;

my $myid  = 'short test sequence';
my $myseq = 'CGGATACTGGGGACTAAGCAGCAGCAGCAGCAGCAGCAGTTT';

find_cag_repeat( $myid, $myseq );

sub find_cag_repeat {
    my ( $id, $seq ) = @_;
    if ( $seq =~ /((CAG){6,})/ ) {
        my $len = length($1);    # the string matched within
                                 # the outer parentheses is stored
                                 # in memory and recalled
                                 # with $1
        $id = substr( $id, 0, 20 );
        print "Repeat with length $len found in $id\n";
    }
}