Restriction enzymes

Question # 1 of 4

For these exercises in restriction mapping we will be using the WWW tool Webcutter. To get familiar with Webcutter analyze the following simple sequence:

ATTCGGGACGGAATTCCCTTTCTCTTAATTCTAC

Paste this sequence in the sequence window of Webcutter. What 'sixcutter' enzyme cleaves in this sequence?

 

[To the main page]