


The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.


Search for patterns in nucleotide sequences


fuzznuc searches for a specified PROSITE-style pattern in nucleotide sequences. Such patterns are specifications of a (typically short) length of sequence to be found. They can specify a search for an exact sequence or they can allow various ambiguities, matches to variable lengths of sequence and repeated subsections of the sequence. One or more nucleotide sequences are read from file. The output is a standard EMBOSS report file that includes data such as location and score of any matches.


fuzznuc intelligently selects the optimum searching algorithm to use, depending on the complexity of the search pattern specified.


Here is a sample session with fuzznuc

% fuzznuc 
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): tembl:L46634
Search pattern: AAGCTT
Output report [l46634.fuzznuc]: 

Go to the input files for this example
Go to the output files for this example

Example 2

% fuzznuc 
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): tembl:L46634
Search pattern: @nucseq.pat
Output report [l46634.fuzznuc]: 

Go to the input files for this example
Go to the output files for this example

Example 3

% fuzznuc -pname test 
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): tembl:L46634
Search pattern: @nucsimple.pat
Output report [l46634.fuzznuc]: 

Go to the input files for this example
Go to the output files for this example

Example 4

% fuzznuc 
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): tembl:L46634
Search pattern: @nuc.pat
Output report [l46634.fuzznuc]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Search for patterns in nucleotide sequences
Version: EMBOSS:

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -pattern            pattern    The standard IUPAC one-letter codes for the
                                  nucleotides are used.
                                  The symbol 'n' is used for a position where
                                  any nucleotide is accepted.
                                  Ambiguities are indicated by listing the
                                  acceptable nucleotides for a given position,
                                  between square parentheses '[ ]'. For
                                  example: [ACG] stands for A or C or G.
                                  Ambiguities are also indicated by listing
                                  between a pair of curly brackets '{ }' the
                                  nucleotides that are not accepted at a given
                                  position. For example: {AG} stands for any
                                  nucleotides except A and G.
                                  Each element in a pattern is separated from
                                  its neighbor by a '-'. (Optional in
                                  Repetition of an element of the pattern can
                                  be indicated by following that element with
                                  a numerical value or a numerical range
                                  between parenthesis. Examples: N(3)
                                  corresponds to N-N-N, N(2,4) corresponds to
                                  N-N or N-N-N or N-N-N-N.
                                  When a pattern is restricted to either the
                                  5' or 3' end of a sequence, that pattern
                                  either starts with a '<' symbol or
                                  respectively ends with a '>' symbol.
                                  A period ends the pattern. (Optional in
                                  For example, [CG](5)TG{A}N(1,5)C
  [-outfile]           report     [*.fuzznuc] Output report file name (default
                                  -rformat seqtable)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -complement         boolean    [N] Search complementary strand

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-pattern" associated qualifiers
   -pformat            string     File format
   -pmismatch          integer    Pattern mismatch
   -pname              string     Pattern base name

   "-outfile" associated qualifiers
   -rformat2           string     Report format
   -rname2             string     Base file name
   -rextension2        string     File name extension
   -rdirectory2        string     Output directory
   -raccshow2          boolean    Show accession number in the report
   -rdesshow2          boolean    Show description in the report
   -rscoreshow2        boolean    Show the score in the report
   -rstrandshow2       boolean    Show the nucleotide strand in the report
   -rusashow2          boolean    Show the full USA in the report
   -rmaxall2           integer    Maximum total hits to report
   -rmaxseq2           integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
-pattern pattern The standard IUPAC one-letter codes for the nucleotides are used. The symbol 'n' is used for a position where any nucleotide is accepted. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G. Each element in a pattern is separated from its neighbor by a '-'. (Optional in fuzznuc). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N. When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzznuc). For example, [CG](5)TG{A}N(1,5)C Property value(s)  
(Parameter 2)
report Output report file name (default -rformat seqtable) <*>.fuzznuc
Additional (Optional) qualifiers
Advanced (Unprompted) qualifiers
-complement boolean Search complementary strand Boolean value Yes/No No
Associated qualifiers
"-sequence" associated seqall qualifiers
integer Start of each sequence to be used Any integer value 0
integer End of each sequence to be used Any integer value 0
boolean Reverse (if DNA) Boolean value Yes/No N
boolean Ask for begin/end/reverse Boolean value Yes/No N
boolean Sequence is nucleotide Boolean value Yes/No N
boolean Sequence is protein Boolean value Yes/No N
boolean Make lower case Boolean value Yes/No N
boolean Make upper case Boolean value Yes/No N
string Input sequence format Any string  
string Database name Any string  
string Entryname Any string  
string UFO features Any string  
string Features format Any string  
string Features file name Any string  
"-pattern" associated pattern qualifiers
-pformat string File format Any string  
-pmismatch integer Pattern mismatch Any integer value 0
-pname string Pattern base name Any string  
"-outfile" associated report qualifiers
string Report format Any string seqtable
string Base file name Any string  
string File name extension Any string  
string Output directory Any string  
boolean Show accession number in the report Boolean value Yes/No N
boolean Show description in the report Boolean value Yes/No N
boolean Show the score in the report Boolean value Yes/No Y
boolean Show the nucleotide strand in the report Boolean value Yes/No Y
boolean Show the full USA in the report Boolean value Yes/No N
integer Maximum total hits to report Any integer value 0
integer Maximum hits to report for one sequence Any integer value 0
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

fuzznuc reads in one or more nucleotide sequences.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

'tembl:L46634' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:L46634

ID   L46634; SV 1; linear; genomic DNA; STD; VRL; 1272 BP.
AC   L46634; L46689;
DT   06-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 3)
DE   Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.
KW   telomeric repeat.
OS   Human herpesvirus 7
OC   Viruses; dsDNA viruses, no RNA stage; Herpesvirales; Herpesviridae;
OC   Betaherpesvirinae; Roseolovirus.
RN   [1]
RP   1-1272
RX   PUBMED; 7494318.
RA   Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,
RA   Berneman Z.N., Reitz M.S.Jr., Dewhurst S.;
RT   "Identification of human telomeric repeat motifs at the genome termini of
RT   human herpesvirus 7: structural analysis and heterogeneity";
RL   J. Virol. 69(12):8041-8045(1995).
FH   Key             Location/Qualifiers
FT   source          1..1272
FT                   /organism="Human herpesvirus 7"
FT                   /strain="JI"
FT                   /mol_type="genomic DNA"
FT                   /clone="ED132'1.2"
FT                   /db_xref="taxon:10372"
FT   repeat_region   207..928
FT                   /note="long and complex repeat region composed of various
FT                   direct repeats, including TAACCC (TRS), degenerate copies
FT                   of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"
FT   misc_signal     938..998
FT                   /note="pac2 motif"
FT   misc_feature    1009
FT                   /note="right genome terminus (...ACA)"
SQ   Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;
     aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca        60
     ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc       120
     tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa       180
     ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca       240
     actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc       300
     taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc       360
     taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc       420
     tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac       480
     cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc       540
     taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg       600
     gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc       660
     ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg       720
     cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac       780
     cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta       840
     accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta       900
     accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc       960
     cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac      1020
     gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt      1080
     agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga      1140
     aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca      1200
     agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa      1260
     gttttcaagc tt                                                          1272

Input files for usage example 2

File: nucseq.pat


Input files for usage example 3

File: nucsimple.pat


Input files for usage example 4

File: nuc.pat

>pat2 <mismatch=1>

Pattern specification

Patterns for fuzznuc are based on the format of pattern used in the PROSITE database, with the difference that the terminating dot '.' and the hyphens, '-', between the characters are optional.

The PROSITE pattern definition from the PROSITE documentation (amended to refer to nucleic acid sequences, not proteins) follows.

For example, in the EMBL entry J01636 you can look for the pattern:


This searches for "C or G" 5 times, followed by T and G, then anything except A, then any base (1 to 5 times) before a C.

You can use ambiguity codes for nucleic acid searches but not within [] or {} as they expand to bracketed counterparts. For example, "s" is expanded to "[GC]" therefore [S] would be expanded to [[GC]] which is illegal.

Note the use of X is reserved for proteins. You must use N for nucleic acids to refer to any base.

The search is case-independent, so 'AAA' matches 'aaa'.

Output file format

The output is a standard EMBOSS report file.

The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.

By default fuzznuc writes a 'seqtable' report file.

Output files for usage example

File: l46634.fuzznuc

# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern AAGCTT
# Report_format: seqtable
# Report_file: l46634.fuzznuc

# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
# Pattern_name Mismatch Pattern
# pattern             0 AAGCTT
# Complement: No

  Start     End  Strand Pattern         Mismatch Sequence
      1       6       + pattern: AAGCTT        . aagctt
   1267    1272       + pattern: AAGCTT        . aagctt


# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2

Output files for usage example 2

File: l46634.fuzznuc

# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nucseq.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc

# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
# Pattern_name Mismatch Pattern
# targetseq           0 cg(2)c(3)taaccctagc(3)ta
# Complement: No

  Start     End  Strand Pattern                             Mismatch Sequence
    429     448       + targetseq: cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    491     510       + targetseq: cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta


# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2

Output files for usage example 3

File: l46634.fuzznuc

# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
#    -pname test
#    -sequence tembl:L46634
#    -pattern @../../data/nucsimple.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc

# Sequence: L46634     from: 1   to: 1272
# HitCount: 13
# Pattern_name Mismatch Pattern
# test1               0 cg(2)c(3)taac
# test2               0 cctagc(3)ta
# Complement: No

  Start     End  Strand Pattern              Mismatch Sequence
    429     438       + test1: cg(2)c(3)taac        . cggccctaac
    491     500       + test1: cg(2)c(3)taac        . cggccctaac
    535     544       + test1: cg(2)c(3)taac        . cggccctaac
    605     614       + test1: cg(2)c(3)taac        . cggccctaac
    631     640       + test1: cg(2)c(3)taac        . cggccctaac
    695     704       + test1: cg(2)c(3)taac        . cggccctaac
    721     730       + test1: cg(2)c(3)taac        . cggccctaac
    753     762       + test1: cg(2)c(3)taac        . cggccctaac
    293     302       + test2: cctagc(3)ta          . cctagcccta
    439     448       + test2: cctagc(3)ta          . cctagcccta
    469     478       + test2: cctagc(3)ta          . cctagcccta
    501     510       + test2: cctagc(3)ta          . cctagcccta
    801     810       + test2: cctagc(3)ta          . cctagcccta


# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 13

Output files for usage example 4

File: l46634.fuzznuc

# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nuc.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc

# Sequence: L46634     from: 1   to: 1272
# HitCount: 19
# Pattern_name Mismatch Pattern
# pat1                0 cggccctaaccctagcccta
# pat2                1 cg(2)c(3)taaccctagc(3)ta
# pat3                0 cggc(2,4)taac(2,5)
# Complement: No

  Start     End  Strand Pattern                        Mismatch Sequence
    429     448       + pat1: cggccctaaccctagcccta            . cggccctaaccctagcccta
    491     510       + pat1: cggccctaaccctagcccta            . cggccctaaccctagcccta
    429     448       + pat2: cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    491     510       + pat2: cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    535     554       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    605     624       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    631     650       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    695     714       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    721     740       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    753     772       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    791     810       + pat2: cg(2)c(3)taaccctagc(3)ta        1 cggcccgaaccctagcccta
    753     764       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    721     732       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    695     706       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    631     642       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    605     616       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    535     546       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    491     502       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc
    429     440       + pat3: cggc(2,4)taac(2,5)              . cggccctaaccc


# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 19

Data files








Diagnostic Error Messages


Exit status

It always exits with a status of 0.

Known bugs


See also

Program name Description
dreg Regular expression search of nucleotide sequence(s)
fuzztran Search for patterns in protein sequences (translated)


Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.


Written (2000) - Alan Bleasby
'-usa' added (13 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

