dan

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Calculates nucleic acid melting temperature

Description

Dan calculates the melting temperature (Tm) and the percentage of G+C nucleotides for windows over a nucleic acid sequence, optionally plotting them. If a plot is not being produced, dan reports the sequence of each oligomer window, its melting temperature under the specified conditions and its percentage GC content. The change in enthalpy (H), entropy (S) and Gibbs free energy (S) for dissociation of the oligomers may (optionally) be reported to file (but not plotted).

Algorithm

The values of melting point and other thermodynamic properties of the sequence, namely change in enthalpy (H), entropy (S) and Gibbs free energy (S) on dissociation, are calculated for a sequence region (or "window") of a user-specified size (see "-windowsize" option). The window is incrementally moved along the sequence with the properties being calculated at each new position. The user must provide the salt and DNA concentration. Optionally, the percent formamide, percent of mismatches allowed and product length may be specified.

For the melting temperature profile, free energy values calculated from nearest neighbor thermodynamics are used (Breslauer et al. Proc. Natl. Acad. Sci. USA 83, 3746-3750, Baldino et al. Methods in Enzymol. 168, 761-777, Allawi and SantaLucia (1997), Biochemistry 36:10581-10594).

Usage

Here is a sample session with dan


% dan 
Calculates nucleic acid melting temperature
Input nucleotide sequence(s): tembl:x13776
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Output report [x13776.dan]: 

Go to the input files for this example
Go to the output files for this example

Example 2

An example of producing a plot of Tm:


% dan -plot -graph cps 
Calculates nucleic acid melting temperature
Input nucleotide sequence(s): tembl:x13776
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Enter minimum temperature [55.]: 

Created dan.ps

Go to the output files for this example

Command line arguments

Calculates nucleic acid melting temperature
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -windowsize         integer    [20] The values of melting point and other
                                  thermodynamic properties of the sequence are
                                  determined by taking a short length of
                                  sequence known as a window and determining
                                  the properties of the sequence in that
                                  window. The window is incrementally moved
                                  along the sequence with the properties being
                                  calculated at each new position. (Integer
                                  from 1 to 100)
   -shiftincrement     integer    [1] This is the amount by which the window
                                  is moved at each increment in order to find
                                  the melting point and other properties along
                                  the sequence. (Integer 1 or more)
   -dnaconc            float      [50.] Enter DNA concentration (nM) (Number
                                  from 1.000 to 100000.000)
   -saltconc           float      [50.] Enter salt concentration (mM) (Number
                                  from 1.000 to 1000.000)
*  -mintemp            float      [55.] Enter a minimum value for the
                                  temperature scale (y-axis) of the plot.
                                  (Number from 0.000 to 150.000)
*  -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tek, tekt, none, data, xterm, png, gif, pdf,
                                  svg)
*  -outfile            report     [*.dan] If a plot is not being produced then
                                  data on the melting point etc. in each
                                  window along the sequence is output to the
                                  file. (default -rformat seqtable)

   Additional (Optional) qualifiers (* if not always prompted):
   -product            toggle     This prompts for percent formamide, percent
                                  of mismatches allowed and product length.
*  -formamide          float      [0.] This specifies the percent formamide to
                                  be used in calculations (it is ignored
                                  unless -product is used). (Number from 0.000
                                  to 100.000)
*  -mismatch           float      [0.] This specifies the percent mismatch to
                                  be used in calculations (it is ignored
                                  unless -product is used). (Number from 0.000
                                  to 100.000)
*  -prodlen            integer    [Window size (20)] This specifies the
                                  product length to be used in calculations
                                  (it is ignored unless -product is used).
                                  (Any integer value)
   -thermo             toggle     Output the DeltaG, DeltaH and DeltaS values
                                  of the sequence windows to the output data
                                  file.
*  -temperature        float      [25.] If -thermo has been specified then
                                  this specifies the temperature at which to
                                  calculate the DeltaG, DeltaH and DeltaS
                                  values. (Number from 0.000 to 100.000)

   Advanced (Unprompted) qualifiers:
   -rna                boolean    This specifies that the sequence is an RNA
                                  sequence and not a DNA sequence.
   -plot               toggle     If this is not specified then the file of
                                  output data is produced, else a plot of the
                                  melting point along the sequence is
                                  produced.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gdesc              string     Graph description
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   "-outfile" associated qualifiers
   -rformat            string     Report format
   -rname              string     Base file name
   -rextension         string     File name extension
   -rdirectory         string     Output directory
   -raccshow           boolean    Show accession number in the report
   -rdesshow           boolean    Show description in the report
   -rscoreshow         boolean    Show the score in the report
   -rstrandshow        boolean    Show the nucleotide strand in the report
   -rusashow           boolean    Show the full USA in the report
   -rmaxall            integer    Maximum total hits to report
   -rmaxseq            integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
-windowsize integer The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window. The window is incrementally moved along the sequence with the properties being calculated at each new position. Integer from 1 to 100 20
-shiftincrement integer This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence. Integer 1 or more 1
-dnaconc float Enter DNA concentration (nM) Number from 1.000 to 100000.000 50.
-saltconc float Enter salt concentration (mM) Number from 1.000 to 1000.000 50.
-mintemp float Enter a minimum value for the temperature scale (y-axis) of the plot. Number from 0.000 to 150.000 55.
-graph xygraph Graph type EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tek, tekt, none, data, xterm, png, gif, pdf, svg EMBOSS_GRAPHICS value, or x11
-outfile report If a plot is not being produced then data on the melting point etc. in each window along the sequence is output to the file. (default -rformat seqtable) <*>.dan
Additional (Optional) qualifiers
-product toggle This prompts for percent formamide, percent of mismatches allowed and product length. Toggle value Yes/No No
-formamide float This specifies the percent formamide to be used in calculations (it is ignored unless -product is used). Number from 0.000 to 100.000 0.
-mismatch float This specifies the percent mismatch to be used in calculations (it is ignored unless -product is used). Number from 0.000 to 100.000 0.
-prodlen integer This specifies the product length to be used in calculations (it is ignored unless -product is used). Any integer value Window size (20)
-thermo toggle Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file. Toggle value Yes/No No
-temperature float If -thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values. Number from 0.000 to 100.000 25.
Advanced (Unprompted) qualifiers
-rna boolean This specifies that the sequence is an RNA sequence and not a DNA sequence. Boolean value Yes/No No
-plot toggle If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced. Toggle value Yes/No No
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1
-sbegin_sequence
integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-graph" associated xygraph qualifiers
-gprompt boolean Graph prompting Boolean value Yes/No N
-gdesc string Graph description Any string DNA melting plot
-gtitle string Graph title Any string  
-gsubtitle string Graph subtitle Any string  
-gxtitle string Graph x axis title Any string  
-gytitle string Graph y axis title Any string  
-goutfile string Output file for non interactive displays Any string  
-gdirectory string Output directory Any string  
"-outfile" associated report qualifiers
-rformat string Report format Any string seqtable
-rname string Base file name Any string  
-rextension string File name extension Any string  
-rdirectory string Output directory Any string  
-raccshow boolean Show accession number in the report Boolean value Yes/No N
-rdesshow boolean Show description in the report Boolean value Yes/No N
-rscoreshow boolean Show the score in the report Boolean value Yes/No Y
-rstrandshow boolean Show the nucleotide strand in the report Boolean value Yes/No Y
-rusashow boolean Show the full USA in the report Boolean value Yes/No N
-rmaxall integer Maximum total hits to report Any integer value 0
-rmaxseq integer Maximum hits to report for one sequence Any integer value 0
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

dan reads one or more nucleotide sequences.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:x13776

ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene (amiR) of
RT   Pseudomonas aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA sequence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   InterPro; IPR003211; AmiSUreI_transpt.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Output file format

If a plot is not being produced, dan reports the sequence of each oligomer window, its melting temperature under the specified conditions and its GC content.

The output is a standard EMBOSS report file.

The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.

By default dan writes a 'seqtable' report file.

The output is to the specified graphics device.

The results can be output in one of several formats by using the command-line qualifier -graph xxx, where 'xxx' is replaced by the name of the required device. Support depends on the availability of third-party software packages.

The device names that output to a file are: ps (postscript), cps (colourps), png, gif, pdf, svg, hpgl, hp7470, hp7580, das, data.

The other available device names are: meta, x11 (xwindows), tek (tek4107t), tekt (tektronix), xterm, text.

Output can be turned off by specifying none (null).

See: http://emboss.sf.net/docs/themes/GraphicsDevices.html for further information on supported devices.

If the -plot qualifier is used, graphical output is produced instead.

Output files for usage example

File: x13776.dan

########################################
# Program: dan
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: dan
#    -sequence tembl:x13776
# Report_format: seqtable
# Report_file: x13776.dan
########################################

#=======================================
#
# Sequence: X13776     from: 1   to: 2167
# HitCount: 2148
#=======================================

  Start     End  Strand     Tm     GC DeltaG DeltaH DeltaS TmProd Sequence
      1      20       +   64.9   70.0      .      .      .      . ggtaccgctggccgagcatc
      2      21       +   63.7   65.0      .      .      .      . gtaccgctggccgagcatct
      3      22       +   63.7   65.0      .      .      .      . taccgctggccgagcatctg
      4      23       +   66.9   70.0      .      .      .      . accgctggccgagcatctgc
      5      24       +   66.7   70.0      .      .      .      . ccgctggccgagcatctgct
      6      25       +   65.5   70.0      .      .      .      . cgctggccgagcatctgctc
      7      26       +   65.5   70.0      .      .      .      . gctggccgagcatctgctcg
      8      27       +   63.7   65.0      .      .      .      . ctggccgagcatctgctcga
      9      28       +   62.9   60.0      .      .      .      . tggccgagcatctgctcgat
     10      29       +   62.6   65.0      .      .      .      . ggccgagcatctgctcgatc
     11      30       +   61.7   60.0      .      .      .      . gccgagcatctgctcgatca
     12      31       +   60.2   60.0      .      .      .      . ccgagcatctgctcgatcac
     13      32       +   60.2   60.0      .      .      .      . cgagcatctgctcgatcacc
     14      33       +   59.0   55.0      .      .      .      . gagcatctgctcgatcacca
     15      34       +   59.2   55.0      .      .      .      . agcatctgctcgatcaccac
     16      35       +   60.4   60.0      .      .      .      . gcatctgctcgatcaccacc
     17      36       +   58.9   55.0      .      .      .      . catctgctcgatcaccacca
     18      37       +   58.6   55.0      .      .      .      . atctgctcgatcaccaccag
     19      38       +   61.3   60.0      .      .      .      . tctgctcgatcaccaccagc
     20      39       +   62.4   65.0      .      .      .      . ctgctcgatcaccaccagcc
     21      40       +   63.9   65.0      .      .      .      . tgctcgatcaccaccagccg
     22      41       +   64.9   70.0      .      .      .      . gctcgatcaccaccagccgg
     23      42       +   64.3   70.0      .      .      .      . ctcgatcaccaccagccggg
     24      43       +   66.1   70.0      .      .      .      . tcgatcaccaccagccgggc
     25      44       +   67.5   75.0      .      .      .      . cgatcaccaccagccgggcg
     26      45       +   66.1   70.0      .      .      .      . gatcaccaccagccgggcga
     27      46       +   66.3   70.0      .      .      .      . atcaccaccagccgggcgac
     28      47       +   68.6   75.0      .      .      .      . tcaccaccagccgggcgacg
     29      48       +   69.8   80.0      .      .      .      . caccaccagccgggcgacgg
     30      49       +   70.7   80.0      .      .      .      . accaccagccgggcgacggg
     31      50       +   70.5   80.0      .      .      .      . ccaccagccgggcgacggga
     32      51       +   68.6   75.0      .      .      .      . caccagccgggcgacgggaa
     33      52       +   68.6   75.0      .      .      .      . accagccgggcgacgggaac
     34      53       +   68.4   75.0      .      .      .      . ccagccgggcgacgggaact


  [Part of this file has been deleted for brevity]

   2101    2120       +   69.9   80.0      .      .      .      . ggccggagcgctgaccctgc
   2102    2121       +   68.7   75.0      .      .      .      . gccggagcgctgaccctgct
   2103    2122       +   65.5   70.0      .      .      .      . ccggagcgctgaccctgcta
   2104    2123       +   63.5   65.0      .      .      .      . cggagcgctgaccctgctat
   2105    2124       +   61.3   60.0      .      .      .      . ggagcgctgaccctgctatt
   2106    2125       +   60.1   60.0      .      .      .      . gagcgctgaccctgctattc
   2107    2126       +   61.7   60.0      .      .      .      . agcgctgaccctgctattcg
   2108    2127       +   63.4   65.0      .      .      .      . gcgctgaccctgctattcgc
   2109    2128       +   61.7   60.0      .      .      .      . cgctgaccctgctattcgct
   2110    2129       +   59.5   55.0      .      .      .      . gctgaccctgctattcgctt
   2111    2130       +   57.1   50.0      .      .      .      . ctgaccctgctattcgcttt
   2112    2131       +   56.4   45.0      .      .      .      . tgaccctgctattcgctttt
   2113    2132       +   54.7   45.0      .      .      .      . gaccctgctattcgctttta
   2114    2133       +   55.0   45.0      .      .      .      . accctgctattcgcttttac
   2115    2134       +   55.9   50.0      .      .      .      . ccctgctattcgcttttacc
   2116    2135       +   54.7   45.0      .      .      .      . cctgctattcgcttttacct
   2117    2136       +   52.0   40.0      .      .      .      . ctgctattcgcttttaccta
   2118    2137       +   51.2   35.0      .      .      .      . tgctattcgcttttacctat
   2119    2138       +   50.9   40.0      .      .      .      . gctattcgcttttacctatc
   2120    2139       +   49.0   35.0      .      .      .      . ctattcgcttttacctatct
   2121    2140       +   49.3   35.0      .      .      .      . tattcgcttttacctatctg
   2122    2141       +   51.1   35.0      .      .      .      . attcgcttttacctatctgt
   2123    2142       +   52.2   40.0      .      .      .      . ttcgcttttacctatctgtg
   2124    2143       +   54.0   45.0      .      .      .      . tcgcttttacctatctgtgg
   2125    2144       +   55.2   50.0      .      .      .      . cgcttttacctatctgtggg
   2126    2145       +   53.9   45.0      .      .      .      . gcttttacctatctgtgggt
   2127    2146       +   52.3   45.0      .      .      .      . cttttacctatctgtgggtg
   2128    2147       +   53.5   45.0      .      .      .      . ttttacctatctgtgggtgg
   2129    2148       +   56.0   50.0      .      .      .      . tttacctatctgtgggtggc
   2130    2149       +   57.8   55.0      .      .      .      . ttacctatctgtgggtggcc
   2131    2150       +   60.1   60.0      .      .      .      . tacctatctgtgggtggccg
   2132    2151       +   63.4   65.0      .      .      .      . acctatctgtgggtggccgc
   2133    2152       +   64.3   70.0      .      .      .      . cctatctgtgggtggccgcc
   2134    2153       +   63.4   65.0      .      .      .      . ctatctgtgggtggccgcca
   2135    2154       +   62.7   60.0      .      .      .      . tatctgtgggtggccgccaa
   2136    2155       +   64.5   65.0      .      .      .      . atctgtgggtggccgccaac
   2137    2156       +   66.5   70.0      .      .      .      . tctgtgggtggccgccaacc
   2138    2157       +   66.8   70.0      .      .      .      . ctgtgggtggccgccaacca
   2139    2158       +   66.8   70.0      .      .      .      . tgtgggtggccgccaaccag
   2140    2159       +   66.8   70.0      .      .      .      . gtgggtggccgccaaccagt
   2141    2160       +   65.9   65.0      .      .      .      . tgggtggccgccaaccagtt
   2142    2161       +   65.6   70.0      .      .      .      . gggtggccgccaaccagttc
   2143    2162       +   65.6   70.0      .      .      .      . ggtggccgccaaccagttcc
   2144    2163       +   64.4   65.0      .      .      .      . gtggccgccaaccagttcct
   2145    2164       +   64.1   65.0      .      .      .      . tggccgccaaccagttcctc
   2146    2165       +   65.4   70.0      .      .      .      . ggccgccaaccagttcctcg
   2147    2166       +   64.2   65.0      .      .      .      . gccgccaaccagttcctcga
   2148    2167       +   62.4   65.0      .      .      .      . ccgccaaccagttcctcgag

#---------------------------------------
#---------------------------------------

Output files for usage example 2

Graphics File: dan.ps

[dan results]

The header information contains details of the program, date and sequence

Subsequent lines contain columns of data for each window into the sequence as it is moved along, giving:

If the qualifier '-product' is used to make the program prompt for percent formamide percent of mismatches allowed and product length, then the output includes the melting temperature of the specified product.

If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS of the sequence in the window is also output.

Data files

The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in the entropy/enthalpy/energy data for DNA and RNA respectively.

EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.

To see the available EMBOSS data files, run:

% embossdata -showall

To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:


% embossdata -fetch -file Exxx.dat

Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".

The directories are searched in the following order:

Notes

The enthalpy of a reaction equates to the "heat" of the reaction so long as temperate and pressure are constant. Enthalpy depends upon the strength of the chemical bonds and non-bonding interactions involved. The entropy of a reaction reflects the level of disorder or randomness of the molecules involved. The higher the entropy, the greater the disorder. The free energy of a reaction reflects it's ability to do work. It helps one determine whether a reaction is feasible given a set of conditions and it's quilibrium.

References

  1. Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). "Predicting DNA Duplex Stability from the Base Sequence." Proceedings of the National Academy of Sciences USA 83, 3746-3750.
  2. Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168, 761-777, Academic Press, San Diego, California, USA.
  3. Allawi H.T. and SantaLucia J. Jr. (1997), "Thermodynamics and NMR of Internal G*T Mismatches in DNA" Biochemistry 36, 10581-10594.

Warnings

RNA sequences must be submited to this application with the '-rna' qualifier on the command line, otherwise the sequence will be assumed to be DNA.

Diagnostic Error Messages

None.

Exit status

0 if successful.

Known bugs

None.

See also

Program name Description
banana Plot bending and curvature data for B-DNA
btwisted Calculate the twisting in a B-DNA sequence
chaos Draw a chaos game representation plot for a nucleotide sequence
compseq Calculate the composition of unique words in sequences
density Draw a nucleic acid density plot
freak Generate residue/base frequency table or plot
isochore Plots isochores in DNA sequences
wordcount Count and extract unique words in molecular sequence(s)

Author(s)

This program was originally included in EGCG under the names "MELT" and "MELTPLOT", written by Rodrigo Lopez
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

This application was written by Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Written (1999) - Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None